You have no items in your shopping cart.
Description
Research Area
Immunology & Inflammation
Images & Validation
−
| Application Notes |
|---|
Key Properties
−| Expression System | E.coli |
|---|---|
| Tag | His-tag |
| Expression Region | pet-22b(+) |
| Purification | Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE). |
| MW | ~45kDa |
| Protein Sequence | CAGATTGTTGCAACCAATCTGCCGCCGGAAGATCAGGATGGCAGTGGCGATGATAGTGATAACTTCAGCGGCAGTGGTGCCGGCGCCCTGCAGGATATTACCCTGAGTCAGCAGACCCCGAGTACCTGGAAAGATACCCAGCTGCTGACCGCCATTCCGACCAGTCCGGAACCGACCGGCCTGGAAGCAACCGCAGCAAGCACCAGTACCCTGCCGGCAGGCGAAGGTCCGAAAGAAGGTGAAGCCGTTGTGCTGCCGGAAGTGGAACCGGGCCTGACCGCCCGTGAACAGGAAGCCACCCCGCGTCCGCGCGAAACCACCCAACTGCCGACCACCCATCTGGCAAGCACCACCACCGCAACCACCGCCCAGGAACCGGCAACCAGCCATCCGCATCGCGATATGCAGCCGGGTCATCATGAAACCAGCACCCCGGCAGGTCCGAGCCAGGCTGATCTGCATACCCCGCATACCGAAGATGGCGGTCCGAGTGCCACCGAACGTGCAGCAGAAGATGGTGCAAGTAGTCAGCTGCCGGCCGCCGAAGGCAGCGGTGAACAGGACTTCACCTTCGAAACCAGTGGCGAAAATACCGCAGTTGTGGCAGTTGAACCGGATCGCCGCAATCAGAGTCCGGTGGATCAGGGTGCCACCGGTGCCAGTCAGGGCCTGCTGGATCGTAAAGAAGTGCTGGGT |
Storage & Handling
−| Storage | Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles. |
|---|---|
| Buffer/Preservatives | PBS, 4M Urea, pH 7.4 |
| Concentration | > 0.5mg/ml |
| Expiration Date | 6 months from date of receipt. |
| Disclaimer | For research use only |
Similar Products
−- Item 1 of 9
SDC1 Antibody [orb3160167]
ELISA, ICC, IHC, WB
Human, Mouse, Rat
Rabbit
Polyclonal
Unconjugated
100 μl, 50 μl - Item 1 of 2
Recombinant Human SDC1 Protein [orb2994757]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE.
Predicted: 51 KDa. Observed: 80-90 KDa, reducing conditions
50 μg, 500 μg, 1 mg, 10 μgRecombinant Human SDC1 Protein [orb2994796]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE.
Predicted: 25.2 KDa. Observed: 45-60 KDa, reducing conditions
10 μg, 50 μg, 500 μg, 1 mgRecombinant Mouse SDC1 Protein [orb2992551]
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 51.1 KDa. Observed: 65-110 KDa, reducing conditions
10 μg, 50 μg, 500 μg, 1 mg
Quality Guarantee
Explore bioreagents carefree to elevate your research. All our products are rigorously tested for performance. If a product does not perform as described on its datasheet, our scientific support team will provide expert troubleshooting, a prompt replacement, or a refund. For full details, please see our Terms & Conditions and Buying Guide. Contact us at [email protected].
Quick Database Links
UniProt
UniProt Details
− No UniProt data available
Protocol Information
Protein Handling and Storage Guide
Protein Handling Guide
Available Sizes
Select a size below
Usually dispatched within 5-10 working days