You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb529181 |
---|---|
Category | Tools |
Description | NME4 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC017067 |
atgggcggcctcttctggcgctccgcgctgcgggggctgcgctgcggcccgcgggccccgggcccgagcctgctagtgcgccacggctcgggagggccctcctggacccgggagcggaccctggtggcggtgaagcccgatggcgtgcaacggcggctcgttggggacgtgatccagcgctttgagaggcggggcttcacgctggtggggatgaagatgctgcaggcaccagagagcgtccttgccgagcactaccaggacctgcggaggaagcccttctaccctgccctcatccgctacatgagctctgggcctgtggtggccatggtctgggaagggtacaatgtcgtccgcgcctcaagggccatgattggacacaccgactcggctgaggctgccccaggaaccataaggggtgacttcagcgtccacatcagcaggaatgtcatccacgccagcgactccgtggagggggcccagcgggagatccagctgtggttccagagcagtgagctggtgagctgggcagatgggggccagcacagcagcatccacccagcctga | |
DNA Notes | pUC |
Note | For research use only |
WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Bovine, Canine, Equine, Guinea pig, Mouse, Rabbit, Rat, Zebrafish | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |