You have no items in your shopping cart.
Cart summary
UCN2
Catalog Number: orb527579
Product Properties
| Catalog Number | orb527579 |
|---|---|
| Category | Tools |
| Description | UCN2 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC002647 |
| atgaccaggtgtgctctgctgttgctgatggtcctgatgttgggcagagtcctggttgtcccagtgacccctatcccaaccttccagctccgccctcagaattctccccagaccactccccgacctgcggcctcagagagcccctcagctgctcccacatggccgtgggctgcccagagccactgcagccccacccgccaccctggctcgcgcattgtcctatcgctggatgtccccatcggcctcttgcagatcttactggagcaagcccgggccagggctgccagggagcaggccaccaccaacgcccgcatcctggcccgtgtcggccactgctga | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Images
Similar Products
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
Reviews
UCN2 (orb527579)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review