You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb529044 |
---|---|
Category | Tools |
Description | TNFRSF12A |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC002718 |
atggctcggggctcgctgcgccggttgctgcggctcctcgtgctggggctctggctggcgttgctgcgctccgtggccggggagcaagcgccaggcaccgccccctgctcccgcggcagctcctggagcgcggacctggacaagtgcatggactgcgcgtcttgcagggcgcgaccgcacagcgacttctgcctgggctgcgctgcagcacctcctgcccccttccggctgctttggcccatccttgggggcgctctgagcctgaccttcgtgctggggctgctttctggctttttggtctggagacgatgccgcaggagagagaagttcaccacccccatagaggagaccggcggagagggctgcccagctgtggcgctgatccagtga | |
DNA Notes | pUC |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
> 95 % by SDS-PAGE and HPLC analyses. | |
Approximately 5.6 kDa, a single non-glycosylated polypeptide chain containing 53 amino acids. | |
Escherichia coli |
ELISA, IHC, WB | |
Human | |
Monoclonal | |
Unconjugated |