You have no items in your shopping cart.
Page Not Found
Cart summary
TNFRSF12A
Catalog Number: orb529044
Product Properties
| Catalog Number | orb529044 |
|---|---|
| Category | Tools |
| Description | TNFRSF12A |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC002718 |
| atggctcggggctcgctgcgccggttgctgcggctcctcgtgctggggctctggctggcgttgctgcgctccgtggccggggagcaagcgccaggcaccgccccctgctcccgcggcagctcctggagcgcggacctggacaagtgcatggactgcgcgtcttgcagggcgcgaccgcacagcgacttctgcctgggctgcgctgcagcacctcctgcccccttccggctgctttggcccatccttgggggcgctctgagcctgaccttcgtgctggggctgctttctggctttttggtctggagacgatgccgcaggagagagaagttcaccacccccatagaggagaccggcggagagggctgcccagctgtggcgctgatccagtga | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Images
Similar Products
- Item 1 of 1
Human Tumor Necrosis Factor Receptor Superfamily, Member 12A (TNFRSF12A) ELISA Kit [orb778894]
Human
31.25-2000 pg/mL
9.99 pg/mL
96 T, 48 T 
Human TWEAK R [orb2993998]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE.
Predicted: 32.7 KDa. Observed: 30-40 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μg- Item 1 of 2
- Item 1 of 2
- Item 1 of 1
Recombinant Human TNF-related Weak Inducer of Apoptosis Receptor/TNFRSF12A [orb1906303]
> 95 % by SDS-PAGE and HPLC analyses.
Approximately 5.6 kDa, a single non-glycosylated polypeptide chain containing 53 amino acids.
Escherichia coli
500 μg, 100 μg, 5 μg
Reviews
TNFRSF12A (orb529044)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review