You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb603314 |
---|---|
Category | Tools |
Description | TAC3 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC032145 |
atgaggatcatgctgctattcacagccatcctggccttcagcctagctcagagctttggggctgtctgtaaggagccacaggaggaggtggttcctggcgggggccgcagcaagagggatccagatctctaccagctgctccagagactcttcaaaagccactcatctctggagggattgctcaaagccctgagccaggctagcacagatcctaaggaatcaacatctcccgagaaacgtgacatgcatgacttctttgtgggacttatgggcaagaggagcgtccagccagactctcctacggatgtgaatcaagagaacgtccccagctttggcatcctcaagtatcccccgagagcagaatag | |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
Note | For research use only |
IF, IHC-Fr, IHC-P | |
Bovine, Human, Porcine | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |