You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb600053 |
---|---|
Category | Tools |
Description | RPS27L |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
ATGTGCCAGCGTTGTGGTTTAAAACTAATAGTAATAATATGCTTCTTTGTTCAGTTGGCTAGAGATTTACTACATCCGTCCTTGGAAGAGGAAAAGAAAAAACATAAAAAGAAACGCCTAGTACAAAGTCCAAATTCTTACTTTATGGATGTAAAATGTCCAGGTTGCTACAAGATCACCACGGTTTTCAGCCATGCTCAGACAGTGGTTCTTTGTGTAGGTTGTTCAACAGTGTTGTGCCAGCCTACAGGAGGAAAGGCCAGACTCACAGAAGGTATATCATTTGGCATTCTCCAACCCAGTGATGAGATTGATGATTATAAATGTCTCTATCTTCACTGA | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
Hazard Information | Non-Toxic |
UniProt ID | BC047648 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
ELISA, IHC-P, WB | |
Human, Mouse | |
Polyclonal | |
Unconjugated |
IH, WB | |
Human, Mouse, Primate, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Bovine, Canine, Equine, Goat, Guinea pig, Mouse, Rabbit, Rat, Yeast | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |