You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb597182 |
---|---|
Category | Tools |
Description | PAX3 |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagatcgtggagatggcccaccacggcatccggccctgcgtcatctcgcgccagctgcgcgtgtcccacggctgcgtctccaagatcctgtgcaggtaccaggagactggctccatacgtcctggtgccatcggcggcagcaagcccaagcaggtgacaacgcctgacgtggagaagaaaattgaggaatacaaaagagagaacccgggcatgttcagctgggaaatccgagacaaattactcaaggacgcggtctgtgatcgaaacaccgtgccgtcagtgagttccatcagccgcatcctgagaagtaaattcgggaaaggtgaagaggaggaggccgacttggagaggaaggaggcagaggaaagcgagaagaaggccaaacacagcatcgacggcatcctgagcgagcgaggaaaggccctggtctccggagtttcctcgcattaa | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
Hazard Information | Non-Toxic |
UniProt ID | BC063547 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
ELISA, IHC, WB | |
Bovine, Human, Rat | |
Goat | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P, WB | |
Mouse, Rat | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Bovine, Canine, Equine, Guinea pig, Rabbit, Rat, Yeast | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |