You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527682 |
---|---|
Category | Tools |
Description | MAL |
DNA Notes | pENTR223.1 |
atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtctgtgttctgcttcgtggccaccaccaccttgatcatcctgtacataattggagcccacggtggagagacttcctgggtcaccttggacgcagcctaccactgcaccgctgccctcttttacctcagcgcctcagtcctggaggccctggccaccatcacgatgcaagacggcttcacctacaggcactaccatgaaaacattgctgccgtggtgttctcctacatagccactctgctctacgtggtccatgcggtgttctctttaatcagatggaagtcttcataa | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC000458 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
FC, IF, IHC-Fr, IHC-P, WB | |
Human | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P | |
Human | |
Rabbit | |
Recombinant | |
Unconjugated |