You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb529797 |
|---|---|
| Category | Tools |
| Description | LTB4R |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC004545 |
| atgaacactacatcttctgcagcacccccctcactaggtgtagagttcatctctctgctggctatcatcctgctgtcagtggcgctggctgtggggcttcccggcaacagctttgtggtgtggagtatcctgaaaaggatgcagaagcgctctgtcactgccctgatggtgctgaacctggccctggccgacctggccgtattgctcactgctccctttttccttcacttcctggcccaaggcacctggagttttggactggctggttgccgcctgtgtcactatgtctgcggagtcagcatgtacgccagcgtcctgcttatcacggccatgagtctagaccgctcactggcggtggcccgcccctttgtgtcccagaagctacgcaccaaggcgatggcccggcgggtgctggcaggcatctgggtgttgtcctttctgctggccacacccgtcctcgcgtaccgcacagtagtgccctggaaaacgaacatgagcctgtgcttcccgcggtaccccagcgaagggcaccgggccttccatctaatcttcgaggctgtcacgggcttcctgctgcccttcctggctgtggtggccagctactcggacatagggcgtcggctacaggcccggcgcttccgccgcagccgccgcaccggccgcctggtggtgctcatcatcctgaccttcgccgccttctggctgccctaccacgtggtgaacctggctgaggcgggccgcgcgctggccggccaggccgccgggttagggctcgtggggaagcggctgagcctggcccgcaacgtgctcatcgcactcgccttcctgagcagcagcgtgaaccccgtgctgtacgcgtgcgccggcggcggcctgctgcgctcggcgggcgtgggcttcgtcgccaagctgctggagggcacgggctccgaggcgtccagcacgcgccgcgggggcagcctgggccagaccgctaggagcggccccgccgctttggagcccggcccttccgagagcctcactgcctccagccctttcaagttaaacgaactgaactag | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
ELISA | |
Bovine, Canine, Equine, Guinea pig, Mouse, Porcine, Rabbit, Rat | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Bovine, Mouse, Porcine, Rabbit, Rat | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
IHC, IHC-Fr, IHC-P | |
Equine, Hamster, Human, Monkey, Mouse, Rabbit, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review