You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb529396 |
|---|---|
| Category | Tools |
| Description | IGFBP4 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC016041 |
| atgctgcccctctgcctcgtggccgccctgctgctggccgccgggcccgggccgagcctgggcgacgaagccatccactgcccgccctgctccgaggagaagctggcgcgctgccgcccccccgtgggctgcgaggagctggtgcgagagccgggctgcggctgttgcgccacttgcgccctgggcttggggatgccctgcggggtgtacaccccccgttgcggctcgggcctgcgctgctacccgccccgaggggtggagaagcccctgcacacactgatgcacgggcaaggcgtgtgcatggagctggcggagatcgaggccatccaggaaagcctgcagccctctgacaaggacgagggtgaccaccccaacaacagcttcagcccctgtagcgcccatgaccgcaggtgcctgcagaagcacttcgccaaaattcgagaccggagcaccagtgggggcaagatgaaggtcaatggggcgccccgggaggatgcccggcctgtgccccagggctcctgccagagcgagctgcaccgggcgctggagcggctggccgcttcacagagccgcacccacgaggacctctacatcatccccatccccaactgcgaccgcaacggcaacttccaccccaagcagtgtcacccagctctggatgggcagcgtggcaagtgctggtgtgtggaccggaagacgggggtgaagcttccggggggcctggagccaaagggggagctggactgccaccagctggctgacagctttcgagagtga | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
IHC, WB | |
Bovine, Canine, Equine, Goat, Guinea pig, Rabbit, Rat, Sheep | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
Porcine | |
1.57-100 ng/mL | |
0.65 ng/mL |
Rat | |
0.79-50ng/mL | |
0.47 ng/mL |
Mouse | |
0.63-40ng/mL | |
0.38 ng/mL |
Human | |
3.13-200ng/mL | |
1.21 ng/mL |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review