You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb527565 |
|---|---|
| Category | Tools |
| Description | EPHA4 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC016981 |
| atgtgtgtacataggtgtgagtgtgtgtgtatgcgtgcctgtctgtgtgcgggtgtgtgtatgtgcatagcctcatgcttaggactacccatgaatgttgtggaatgctacacctggagagttctggttttccaccagtttcaagatgaagaactacatgatacagtggacctggagaccatccccttggaaagacaacccagagatgttcagcatcctgtatctacacgcatcctgtatctacacgtgtattttgtagctgtcacactaaccttaataagaattctacagctttggacagaggcattttcaccttaa | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
IHC-P, WB | |
Guinea pig, Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
FC, IF, IHC-P, WB | |
Gallus, Xenopus | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
Human | |
0.32-20 ng/mL | |
0.112 ng/mL |
Unconjugated | |
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. | |
Predicted: 59.2 KDa. Observed: 60-80 KDa, reducing conditions |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review