You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb527510 |
|---|---|
| Category | Tools |
| Description | CLEC7A |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC013385 |
| atggaatatcatcctgatttagaaaatttggatgaagatggatatactcaattacacttcgactctcaaagcaataccaggatagctgttgtttcagagaaaggatcgtgtgctgcatctcctccttggcgcctcattgctgtaattttgggaatcctatgcttggtaatactggtgatagctgtggtcctgggtaccatggctggtttcaaagctgtggaattcaaaggataa | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
FC, WB | |
Rat | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
Human | |
0.16-10 ng/mL | |
0.064 ng/mL |
Mouse | |
0.16-10 ng/mL | |
0.054 ng/mL |
Unconjugated | |
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. | |
Predicted: 46.9 KDa. Observed: 50-65 KDa, reducing conditions |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review