You have no items in your shopping cart.
Cart summary
CLEC12A
Catalog Number: orb529252
Product Properties
| Catalog Number | orb529252 |
|---|---|
| Category | Tools |
| Description | CLEC12A |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC063424 |
| atgtctgaagaagttacttatgcagatcttcaattccagaactccagtgagatggaaaaaatcccagaaattggcaaatttggggaaaaagcacctccagctccctctcatgtatggcgtccagcagccttgtttctgactcttctgtgccttctgttgctcattggattgggagtcttggcaagcatgtttcacgtaactttgaagatagaaatgaaaaaaatgaacaaactacaaaacatcagtgaagagctccagagaaatatttctctacaactgatgagtaacatgaatatctccaacaagatcaggaacctctccaccacactgcaaacaatagccaccaaattatgtcgtgagctatatagcaaagaacaagagcacaaatgtaagccttgtccaaggagatggatttggcataaggacagctgttatttcctaagtgatgatgtccaaacatggcaggagagtaaaatggcctgtgctgctcagaatgccagcctgttgaagataaacaacaaaaatgcattggaatttataaaatcccagagtagatcatatgactattggctgggattatctcctgaagaagattccactcgtggtatgagagtggataatataatcaactcctctgcctga | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Images
Similar Products
Human CLEC12A [orb2992833]
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 24.6 KDa. Observed: 30-58 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μgCynomolgus CLEC12A [orb2992745]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 24 KDa. Observed: 33-58 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μgMouse CLEC12A [orb2992799]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 24.6 Kda. Observed: 26-40 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μgHuman CLEC12A [orb2992868]
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE. (QC verified)
Predicted: 49.5 KDa. Observed: 55-100 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μg- Item 1 of 2
Reviews
CLEC12A (orb529252)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review