You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb602758 |
---|---|
Category | Tools |
Description | CALML5 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC039172 |
atggccggtgagctgactcctgaggaggaggcccagtacaaaaaggctttctccgcggttgacacggatggaaacggcaccatcaatgcccaggagctgggcgcggcgctgaaggccacgggcaagaacctctcggaggcccagctaaggaaactcatctccgaggttgacggcgacggcgacggcgaaatcagcttccaggagttcctgacggcggcaaggaaggccagggccggcctggaggacctgcaggtcgccttccgcgccttcgaccaggatggcgacggccacatcaccgtggacgagctcaggcgggccatggcggggctggggcagccgctgccgcaggaggagctggacgccatgatccgcgaggccgacgtggaccaggacgggcgggtgaactacgaggagttcgcgaggatgctcgcccaggagtga | |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
Note | For research use only |
Greater than 90% as determined by SDS-PAGE. | |
31.8 kDa | |
E.coli |