You have no items in your shopping cart.
Cart summary
CALML5
Catalog Number: orb602758
| Catalog Number | orb602758 |
|---|---|
| Category | Tools |
| Description | CALML5 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC039172 |
| atggccggtgagctgactcctgaggaggaggcccagtacaaaaaggctttctccgcggttgacacggatggaaacggcaccatcaatgcccaggagctgggcgcggcgctgaaggccacgggcaagaacctctcggaggcccagctaaggaaactcatctccgaggttgacggcgacggcgacggcgaaatcagcttccaggagttcctgacggcggcaaggaaggccagggccggcctggaggacctgcaggtcgccttccgcgccttcgaccaggatggcgacggccacatcaccgtggacgagctcaggcgggccatggcggggctggggcagccgctgccgcaggaggagctggacgccatgatccgcgaggccgacgtggaccaggacgggcgggtgaactacgaggagttcgcgaggatgctcgcccaggagtga | |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| Note | For research use only |
- Item 1 of 2
- Item 1 of 3
- Item 1 of 3
- Item 1 of 1
- Item 1 of 1
Human CALML5 protein [orb246668]
Greater than 90% as determined by SDS-PAGE.
31.8 kDa
E.coli
20 μg, 100 μg, 1 mg
