You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb595316 |
|---|---|
| Category | Tools |
| Description | AKT2 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC063421 |
| atgaggtgtctgtcatcaaagaaggctggctccacaagcgtggtgaaatacatcaagacctggaggccacggtacttcctgctgaagagcgacggctccttcattgggtacaaggagaggcccgaggcccctgatcagactctaccccccttaaacaacttctccgtagcagaatgccagctgatgaagaccgagaggccgcgacccaacacctttgtcatacgctgcctgcagtggaccacagtcatcgagaggaccttccacgtggattctccagacgagagggaggagtggatgcgggccatccagatggtcgccaacagcctccagcctcacctttgtgcccagactcgcatttggaagactccacctcccgcccaggcctgggctgttgggcggttggagattcaggttttaatccacacaagccccagtgaggggtga | |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
FC, IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Gallus, Porcine, Rabbit, Sheep | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
FC, ICC, IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Gallus, Porcine, Rabbit, Sheep | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
FC, IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Gallus, Porcine, Rabbit, Sheep | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
FC, ICC, IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Gallus, Porcine, Rabbit, Rat, Sheep | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-P, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review