You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb600996 |
|---|---|
| Category | Tools |
| Description | WFDC5 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC039173 |
| atgaggacccagagccttctcctcctgggggccctcctggctgtggggagtcagctgcctgctgtctttggcaggaagaagggagagaaatcggggggctgcccgccagatgatgggccctgcctcctatcggtgcctgaccagtgcgtggaagacagccagtgtcccttgaccaggaagtgctgctacagagcttgcttccgccagtgtgtccccagggtctctgtgaagctgggcagctgcccagaggaccaactgcgctgcctcagccccatgaaccacctgtgtcacaaggactcagactgctcgggcaaaaagcgatgctgccacagcgcctgcgggcgggattgccgggatcctgccagaggctaa | |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| Note | For research use only |
Human | |
78.13-5000 pg/mL | |
35 pg/mL |
WB | |
Bovine, Guinea pig, Porcine | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review