You have no items in your shopping cart.
Cart summary
PRAP1
Catalog Number: orb529087
Product Properties
| Catalog Number | orb529087 |
|---|---|
| Category | Tools |
| Description | PRAP1 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC071872 |
| atgaggaggctcctcctggtcaccagcctggtggttgtgctgctgtgggaggcaggtgcagtcccagcacccaaggtccctatcaagatgcaagtcaaacactggccctcagagcaggacccagagaaggcctggggcgcccgtgtggtggagcctccggagaaggacgaccagctggtggtgctgttccctgtccagaagccgaaactcttgaccaccgaggagaagccacgaggtcagggcaggggccccatccttccaggcaccaaggcctggatggagaccgaggacaccctgggccgtgtcctgagtcccgagcccgaccatgacagcctgtaccaccctccgcctgaggaggaccagggcgaggagaggccccggttgtgggtgatgccaaatcaccaggtgctcctgggaccggaggaagaccaagaccacatctaccacccccagtag | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Images
Similar Products
- Item 1 of 1
Human Proline-rich acidic Protein 1 (PRAP1) ELISA Kit [orb782844]
Human
78.13-5000 pg/mL
25.2 pg/mL
48 T, 96 T 
Mouse PRAP1(Proline-rich acidic protein 1) ELISA Kit [orb2937755]
0.63-40 ng/mL
0.19 ng/mL
96 T, 48 T
Human PRAP1 [orb2994822]
Unconjugated
SDS-PAGE: Greater than 95% as determined by reducing SDS-PAGE.
Predicted: 16.04 KDa. Observed: 20 KDa, reducing conditions
1 mg, 500 μg, 50 μg, 10 μg- Item 1 of 2
- Item 1 of 1
Reviews
PRAP1 (orb529087)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review