You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb528806 |
---|---|
Category | Tools |
Description | IFI27 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC015492 |
atggaggcctctgctctcacctcatcagcagtgaccagtgtggccaaagtggtcagggtggcctctggctctgccgtagttttgcccctggccaggattgctacagttgtgattggaggagttgtggctgtgcccatggtgctcagtgccatgggcttcactgcggcgggaatcgcctcgtcctccatagcagccaagatgatgtccgcggcggccattgccaatgggggtggagttgcctcgggcagccttgtggctactctgcagtcactgggagcaactggactctccggattgaccaagttcatcctgggctccattgggtctgccattgcggctgtcattgcgaggttctactag | |
DNA Notes | pUC |
Note | For research use only |
WB | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
Human | |
28 pg/mL-1800 pg/mL | |
7 pg/mL |