You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb527795 |
|---|---|
| Category | Tools |
| Description | HPCAL1 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC009846 |
| atgggcaaacagaacagcaagctgcggcccgaggtgctgcaggacctgcgggagaacacggagttcaccgaccacgagctgcaggagtggtacaagggcttcctcaaggactgccccaccggccacctgaccgtggacgagttcaagaagatctacgccaacttcttcccctacggcgacgcttccaagttcgccgagcacgtcttccgcaccttcgacaccaacggcgacggcaccatcgacttccgggagttcatcattgcgctgagcgtgacctcgcggggcaagctggagcagaagctcaagtgggccttcagcatgtacgacctggacggcaacggctacatcagccgcagcgagatgctggagatcgtgcaggccatctacaagatggtgtcgtctgtgatgaagatgccggaggatgagtccaccccggagaagcgcacagacaagatcttcaggcagatggacaccaacaatgacggcaaactgtccttggaagaattcatcagaggtgccaagagcgacccctccatcgtccgcctgctgcagtgcgaccccagcagtgccagtcagttctga | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Human | |
0.16-10 ng/mL | |
0.056 ng/mL |
Unconjugated | |
Predicted: 24.5 KDa. Observed: 21 KDa, reducing conditions |
ELISA, IF, IHC, IP, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review