You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb596457 |
---|---|
Category | Tools |
Description | GYPE |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC017864 |
atgtatggaaaaataatctttgtattactattgtcaggaattgtgagcatatcagcatcaagtaccactggtgtggcaatgcacacttcaacctcttcttcagtcacaaagagttacatctcatcacagacaaatgggataacactcattaattggtgggcgatggctcgtgttatttttgaggtgatgcttgttgttgttggaatgatcatcttaatttcttactgtattcgatga | |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
Note | For research use only |