You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb529121 |
|---|---|
| Category | Tools |
| Description | FAM176B |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC006241 |
| atggatgccccgcgaagggacatggagttgctcagcaacagcctggctgcctacgcgcacatccgcgccaaccccgagagcttcggcctctacttcgtgctgggcgtctgcttcggcctgctgctcaccctctgcctgctcgtcatcagcatctcgtgggcgccccgcccgcggccccggggcccggctcagcgccgggacccccgcagcagcaccctggagcccgaggacgacgacgaggacgaggaggacacggtgactcggctgggccccgacgacacgctgccgggccccgagctgtccgcagagccggacgggcccctcaacgtcaacgtcttcacgtcggcggaggagctggagcgggcgcagcggctggaggagcgcgaacggatcctgcgggagatctggcgcaccgggcagccggacctgctgggcacaggcacgctggggcccagccccacggccacgggcaccctgggccgcatgcactattactga | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
WB | |
Canine, Equine, Goat, Guinea pig, Human, Mouse, Rabbit, Yeast | |
Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 85% as determined by SDS-PAGE. | |
24.4 kDa | |
in vitro E.coli expression system |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review