You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb529121 |
---|---|
Category | Tools |
Description | FAM176B |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC006241 |
atggatgccccgcgaagggacatggagttgctcagcaacagcctggctgcctacgcgcacatccgcgccaaccccgagagcttcggcctctacttcgtgctgggcgtctgcttcggcctgctgctcaccctctgcctgctcgtcatcagcatctcgtgggcgccccgcccgcggccccggggcccggctcagcgccgggacccccgcagcagcaccctggagcccgaggacgacgacgaggacgaggaggacacggtgactcggctgggccccgacgacacgctgccgggccccgagctgtccgcagagccggacgggcccctcaacgtcaacgtcttcacgtcggcggaggagctggagcgggcgcagcggctggaggagcgcgaacggatcctgcgggagatctggcgcaccgggcagccggacctgctgggcacaggcacgctggggcccagccccacggccacgggcaccctgggccgcatgcactattactga | |
DNA Notes | pUC |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
Greater than 85% as determined by SDS-PAGE. | |
24.4 kDa | |
in vitro E.coli expression system |
WB | |
Canine, Equine, Goat, Guinea pig, Human, Mouse, Rabbit, Yeast | |
Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |