You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb528976 |
|---|---|
| Category | Tools |
| Description | FAM167B |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC004269 |
| atgcaggcgcaggacaggcagctggcagggcagctgctgcggctgcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagctgctggatgaggccgagctggagctggagctggagcccggggccggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcagcgcccggcgcttcaccctctgctga | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
IF, IHC-Fr, IHC-P | |
Bovine, Canine, Equine, Human, Porcine, Sheep | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 95% as determined by SDS-PAGE. | |
25.3 kDa | |
E.coli |
IF | |
Bovine, Canine, Equine, Human, Porcine, Sheep | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Cy5.5 |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review