You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb528976 |
---|---|
Category | Tools |
Description | FAM167B |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC004269 |
atgcaggcgcaggacaggcagctggcagggcagctgctgcggctgcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagctgctggatgaggccgagctggagctggagctggagcccggggccggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcagcgcccggcgcttcaccctctgctga | |
DNA Notes | pUC |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
Greater than 95% as determined by SDS-PAGE. | |
25.3 kDa | |
E.coli |
IF, IHC-Fr, IHC-P | |
Bovine, Canine, Equine, Human, Porcine, Sheep | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |