You have no items in your shopping cart.
Cart summary
FAM100A
Catalog Number: orb529148
Product Properties
| Catalog Number | orb529148 |
|---|---|
| Category | Tools |
| Description | FAM100A |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC012018 |
| atgtccgtgaacatggacgagctcaagcaccaggtcatgatcaaccagttcgtgctgacggcgggctgcgcggccgaccaggcgaagcaactgctgcaggcggcccactggcagttcgagacagccctcagcgcctttttccaggagaccaacatcccctacagccaccatcaccaccagatgatgtgcacccccgccaatacccctgctacaccccccaacttccctgacgctctcaccatgttctcccgtctcaaggcctccgagagcttccacagcggtggcagcggcagcccgatggccgcgacagccacgtcacccccgccacacttcccccatgccgccaccagcagctctgcggcctccagctggcccacggcggcctcgcccccggggggcccacagcaccaccagccacagccgcccctgtggactccaacacccccttctccggcttcagactggccacccctggccccccaacaggccacctcagaacccagggcccaccctgccatggaggcagagagataa | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
Images
Similar Products
Reviews
FAM100A (orb529148)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review