You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527803 |
---|---|
Category | Tools |
Description | CRH |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC011031 |
atgcggctgccgctgcttgtgtccgcgggagtcctgctggtggctctcctgccctgcccgccatgcagggcgctcctgagccgcgggccggtcccgggagctcggcaggcgccgcagcaccctcagcccttggatttcttccagccgccgccgcagtccgagcagccccagcagccgcaggctcggccggtcctgctccgcatgggagaggagtacttcctccgcctggggaacctcaacaagagcccggccgctcccctttcgcccgcctcctcgctcctcgccggcggcagcggcagccgcccttcgccggaacaggcgaccgccaactttttccgcgtgttgctgcagcagctgctgctgcctcggcgctcgctcgacagccccgcggctctcgcggagcgcggcgctaggaatgccctcggcggccaccaggaggcaccggagagagaaaggcggtccgaggagcctcccatctccctggatctcaccttccacctcctccgggaagtcttggaaatggccagggccgagcagttagcacagcaagctcacagcaacaggaaactcatggagattattgggaaataa | |
DNA Notes | pENTR223.1 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
IHC-P, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
WB | |
Canine, Gallus, Guinea pig, Human, Porcine, Rabbit | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P, WB | |
Human | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, IF, IHC, WB | |
Bovine, Canine, Rat, Sheep | |
Human, Mouse | |
Goat | |
Polyclonal | |
Unconjugated |