You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb595700 |
|---|---|
| Category | Tools |
| Description | CDC42 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC002711 |
| atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgcagggcaagaggattatgacagattacgaccgctgagttatccacaaacagatgtatttctagtctgtttttcagtggtctctccatcttcatttgaaaacgtgaaagaaaagtgggtgcctgagataactcaccactgtccaaagactcctttcttgcttgttgggactcaaattgatctcagagatgacccctctactattgagaaacttgccaagaacaaacagaagcctatcactccagagactgctgaaaagctggcccgtgacctgaaggctgtcaagtatgtggagtgttctgcacttacacagaaaggcctaaagaatgtatttgacgaagcaatattggctgccctggagcctccagaaccgaagaagagccgcaggtgtgtgctgctatga | |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| Note | For research use only |
FC, ICC, IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Equine, Gallus, Porcine, Rabbit, Sheep | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P, WB | |
Bovine, Canine, Equine, Gallus, Human, Porcine, Rabbit | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Human | |
0.16-10 ng/mL | |
0.062 ng/mL |
Human | |
0.16-10 ng/mL | |
0.057 ng/mL |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review