You have no items in your shopping cart.
Cart summary
CARTPT
Catalog Number: orb528763
Product Properties
| Catalog Number | orb528763 |
|---|---|
| Category | Tools |
| Description | CARTPT |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC029882 |
| atggagagctcccgcgtgaggctgctgcccctcctgggcgccgccctgctgctgatgctacctctgttgggtacccgtgcccaggaggacgccgagctccagccccgagccctggacatctactctgccgtggatgatgcctcccacgagaaggagctgatcgaagcgctgcaagaagtcttgaagaagctcaagagtaaacgtgttcccatctatgagaagaagtatggccaagtccccatgtgtgacgccggtgagcagtgtgcagtgaggaaaggggcaaggatcgggaagctgtgtgactgtccccgaggaacctcctgcaattccttcctcctgaagtgcttatga | |
| DNA Notes | pUC |
| Note | For research use only |
Images
Similar Products
- Item 1 of 1
Human CART(Cocaine And Amphetamine Regulated Transcript) ELISA Kit [orb1948010]
Human
31.25-2000pg/mL
18.75 pg/mL
48 T, 96 T - Item 1 of 2
- Item 1 of 1
- Item 1 of 1
- Item 1 of 1
Reviews
CARTPT (orb528763)
- 0.0
Based on 0 reviews
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review