You have no items in your shopping cart.
You have no items in your shopping cart.

| Catalog Number | orb528974 |
|---|---|
| Category | Tools |
| Description | BEST3 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC006440 |
| atgttcctcatctctagcagtgttcacggaagcgacgagcacgggcgcctgcttagaaggacgctgatgcgctacgtcaatctcacctccctgctcatctttcgctcggtgagcactgctgtgtacaaaagatttcccacaatggaccacgtggttgaagcagaaagaactggcatgaaacccattctgccttcaagttttgagatgcagagcttttag | |
| DNA Notes | pUC |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
WB | |
Bovine, Canine, Equine, Guinea pig, Mouse, Rabbit, Rat, Zebrafish | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
Participating in our Biorbyt product reviews program enables you to support fellow scientists by sharing your firsthand experience with our products.
Login to Submit a Review