You have no items in your shopping cart.
Cart summary
SCGB1A1
Catalog Number: orb527525
| Catalog Number | orb527525 |
|---|---|
| Category | Tools |
| Description | SCGB1A1 |
| UniProt ID | BC004481 |
| Protein Sequence | atgaaactcgctgtcaccctcaccctggtcacactggctctctgctgcagctccgcttctgcagagatctgcccgagctttcagcgtgtcatcgaaaccctcctcatggacacaccctccagttatgaggctgccatggaacttttcagccctgatcaagacatgagggaggcaggggctcagctgaagaagctggtggacaccctcccccaaaagcccagagaaagcatcattaagctcatggaaaaaatagcccaaagctcactgtgtaattag |
| Note | For research use only |
| Application notes | Vector: pENTR223.1 |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 4
- Item 1 of 4
- Item 1 of 4
- Item 1 of 3
- Item 1 of 3
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars