You have no items in your shopping cart.
Cart summary
ROPN1L
Catalog Number: orb601982
| Catalog Number | orb601982 |
|---|---|
| Category | Tools |
| Description | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| UniProt ID | BC014607 |
| Protein Sequence | atgccgcttcccgacaccatgttctgcgctcagcagatccacattcccccggagctgccggacatcctgaagcaattcaccaaggctgccatccgcacccagccggccgacgtgctgcggtggtccgcgggctatttttcagctctgtcgagaggagatccacttcctgtaaaggacagaatggaaatgcccacggcaacccagaaaacagacacaggcctgactcaaggactcctgaaagttttgcacaagcagtgtcaccacaagcggtatgtggaattaacagatcttgagcagaagtggaagaacttgtgcctgccgaaggaaaaattcaaagcgctcttacaactggatccttgtgaaaacaaaatcaagtggataaactttttagcgcttggatgcagcatgcttggtgggtccttgaacactgcgctgaagcacctgtgcgagatcctcacggacgatcgggagggcgggcccgctcgcatccccttcaagacgttttcctacgtttaccgctacttggccagattagactcagatgtgtctcccttggagacggaatcctaccttgcctctctaaaggaaaatatagacgccaggaagaacggcatgataggtctttcagatttcttctttccaaagaggaaacttttagaaagcattgaaaactctgaagatgtaggccattaa |
| Note | For research use only |
| Application notes | Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 2
- Item 1 of 2
- Item 1 of 2
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars