You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb597526 |
---|---|
Category | Tools |
Description | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
UniProt ID | BC000667 |
Protein Sequence | atgcgcgggaagacgttccgctttgaaatgcagcgggatttggtgagtttcccgctgtctccagcggtgcgggtgaagctggtgtctgcggggttccagactgctgaggaactcctagaggtgaaaccctccgagcttagcaaagaagttgggatatctaaagcagaagccttagaaactctgcaaattatcagaagagaatgtctcacaaataaaccaagatatgctggtacatctgagtcacacaagaagtgtacagcactggaacttcttgagcaggagcatacccagggcttcataatcaccttctgttcagcactagatgatattcttgggggtggagtgcccttaatgaaaacaacagaaatttgtggtgcaccaggtgttggaaaaacacaattatga |
Note | For research use only |
Application notes | Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Expiration Date | 12 months from date of receipt. |
IF, IH, WB | |
Human, Primate | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, IF, IHC-P, WB | |
Human, Monkey | |
Rabbit | |
Polyclonal | |
Unconjugated |
Filter by Rating