You have no items in your shopping cart.
Cart summary
PLXNA1
Catalog Number: orb603146
| Catalog Number | orb603146 |
|---|---|
| Category | Tools |
| Description | PLXNA1 |
| atgaagggggtgcaccacaggcctcatgaagcagttcccacatgggcgtgtggctggggcgtggccaccacagagcacatggctgtgtctaggcgcaagcactttagcagtatctgtttacatgcgcaaggatcaagccgactacctgtgctgtctactgggacagcagtctccgagctactccgtacctccctctgccaggtcgtggagttaggccccagtccctacttgtcactggttcccactgtgctcctaactgtgcagcacctgggagctctggcctggggctggaggccctggtag | |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| Hazard Information | Non-Toxic |
| UniProt ID | BC032432 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 2
- Item 1 of 1
Human PLXNA1 protein [orb605153]
Greater than 90% as determined by SDS-PAGE.
33.3 kDa
E.coli
100 μg, 20 μg, 1 mgHuman PLXNA1 protein [orb605152]
Greater than 90% as determined by SDS-PAGE.
22.3 kDa
E.coli
100 μg, 20 μg, 1 mgHuman PLXNA1 protein [orb246200]
Greater than 90% as determined by SDS-PAGE.
20.3 kDa
Yeast
20 μg, 100 μg, 500 μg, 1 mg
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars
