You have no items in your shopping cart.
Cart summary
PILRA
Catalog Number: orb603640
| Catalog Number | orb603640 |
|---|---|
| Category | Tools |
| Description | PILRA |
| DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| atgggtcggcccctgctgctgcccctactgcccctgctgctgccgccagcatttctgcagcctagtggctccacaggatctggtccaagctacctttatggggtcactcaaccaaaacacctctcagcctccatgggtggctctgtggaaatccccttctccttctattacccctgggagttagccacagctcccgacgtgagaatatcctggagacggggccacttccacgggcagtccttctacagcacaaggccgccttccattcacaaggattatgtgaaccggctctttctgaactggacagagggtcagaagagcggcttcctcaggatctccaacctgcagaagcaggaccagtctgtgtatttctgccgagttgagctggacacacggagctcagggaggcagcagtggcagtccatcgaggggaccaaactctccatcacccagggtcagcagcggactaaagccacaaccccagccagggaacccttccaaaacacagaggagccatatgagaatatcaggaatgaaggacaaaatacagatcccaagctaaatcccaagctccacctcacccagagcacctcccagccaccgtcccctcaagagcccccagaacgagaccctgtactctgtcttaaaggcctaaccaatggacagccctctcaagactga | |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| Hazard Information | Non-Toxic |
| UniProt ID | BC017812 |
| Note | For research use only |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 2
- Item 1 of 1
- Item 1 of 1
Human PILRA Protein, hFc Tag [orb1743285]
The purity of the protein is greater than 95% as determined by SDS-PAGE and Coomassie blue staining.
The protein has a predicted molecular mass of 46.2 kDa after removal of the signal peptide. The apparent molecular mass of PILRA-hFc is approximately 55-70 kDa due to glycosylation.
Mammalian
10 μg, 50 μg, 100 μg - Item 1 of 1
- Item 1 of 1
