You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb602910 |
---|---|
Category | Tools |
Description | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
UniProt ID | BC063296 |
Protein Sequence | atgccattacagaaattccattacagaaaccttcttcttggtgaacacgatgtccctttaacatgtattgaacaaattgtcacagtaaacgaccacaagaggaagcagaaagtcctaggccccaaccagaaactgaaatttaatccaacagagttaattatttattgtaaagatttcagaattgtcagatttcgctttgatgaatcaggtcccgaaagtgctaaaaagcaaacaaaattaatggaattccctcaggagatggaggaggaggaggaggaggaggtaatggagctggtggtggcagcagccagaaaactccactctttgaaacttactcggattgggacagagaaatcaagaggacaggtgcttccgggtggagagtttgttctattaacgagggttacatga |
Note | For research use only |
Application notes | Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Expiration Date | 12 months from date of receipt. |
Filter by Rating