Cart summary

You have no items in your shopping cart.

    MT1DP

    MT1DP

    Catalog Number: orb596986

    DispatchUsually dispatched within Please Inquire
    $ 215.00
    Catalog Numberorb596986
    CategoryTools
    DescriptionVector will be determined during the manufacturing process, either pENTR223.1 or pUC
    Hazard InformationNon-Toxic
    UniProt IDBC130315
    Protein Sequenceatggacctcagctgctcctgcgccactggtggctcctgcacctgtgccagctcctgcaaatgcaaagagtacaaatgcacctcctgcaagaagaactgctgctcctgctgccccatgggctgtgccaaatgtgcccagggctgcacctga
    NoteFor research use only
    Application notesVector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
    Expiration Date12 months from date of receipt.
    Submit a review

    Filter by Rating

      • Star
      • Star
      • Star
      • Star
      • Star
      • 5 stars
      • Star
      • Star
      • Star
      • Star
      • Star
      • 4 stars
      • Star
      • Star
      • Star
      • Star
      • Star
      • 3 stars
      • Star
      • Star
      • Star
      • Star
      • Star
      • 2 stars
      • Star
      • Star
      • Star
      • Star
      • Star
      • 1 stars