You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb596492 |
---|---|
Category | Tools |
Description | HBXIP |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
atggagccaggtgcaggtcacctcgacggtcaccgcgcggggagcccaagccttcgtcaggctctgtgcgacggaagcgcagtgatgttttccagtaaagaacgcggacgttgcaccgtgatcaattttgtccctttggaggcgccgttacggtccacgccccgctcgcgtcaagtgactgaggcctgtggtggagaaggacgtgccgtgccgctgggttctgagccggagtggtcggtgggtgggatggaggcgaccttggagcagcacttggaagacacaatgaagaatccctccattgttggagtcctgtgcacagattcacaaggacttaatctgggttgccgcgggaccctgtcagatgagcatgctggagtgatatctgttctagcccagcaagcagctaagctaacctctgaccccactgatattcctgtggtgtgtctagaatcagataatgggaacattatgatccagaaacacgatggcatcacggtggcagtgcacaaaatggcctcttga | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
Hazard Information | Non-Toxic |
UniProt ID | BC062619 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 90% as determined by SDS-PAGE. | |
36.6 kDa | |
E.coli |