You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527499 |
---|---|
Category | Tools |
Description | FOXP2 |
UniProt ID | BC018016 |
Protein Sequence | atgatgcaggaatctgcgacagagacaataagcaacagttcaatgaatcaaaatggaatgagcactctaagcagccaattagatgctggcagcagagatggaagatcaagtggtgacaccagctctgaagtaagcacagtagaactgctgcatctgcaacaacagcaggaggatgttgtctcttacacccaggttatttgttaa |
Note | For research use only |
Application notes | Vector: pENTR223.1 |
Expiration Date | 12 months from date of receipt. |
ELISA, IHC | |
Bovine, Canine, Feline, Human, Mouse, Porcine, Rat, Zebrafish | |
Goat | |
Polyclonal | |
Unconjugated |
Filter by Rating