You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb600274 |
---|---|
Category | Tools |
Description | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
UniProt ID | BC045541 |
Protein Sequence | atgtttcttttgctaaactgcatcgtcgctgtgtcccaaaacatgggcatcggcaagaacggggacctgcccaggccgccgctcaggaatgaattcaggtatttccagagaatgaccacaacttcttcagtagagggtaaacagaatctggtgattatgggtaggaagacctggttctccattcctgagaagaatcgacctttaaaggatagaattaatttagttctcagcagagaactaaaggaacctccacaaggagctcattttcttgccagaagtttggatgatgccttaaaacttactgaacgaccagaattagcaaataaagtagacatgatttggatagttggtggcagttctgtttataaggaagccatgaatcacctaggccatcttaaactatttgtgacaaggatcatgcaggactttgaaagtgacacgtttttttcagaaattgacttggagaaatataaacttctgcctgaatacccaggtgttctctctgatgtccaggaggggaaacacatcaagtacaaatttgaagtatgtgagaaggatgattaa |
Note | For research use only |
Application notes | Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Expiration Date | 12 months from date of receipt. |
IF, WB | |
Canine, Human, Monkey, Mouse | |
Mouse | |
Monoclonal | |
Unconjugated |
Filter by Rating