You have no items in your shopping cart.
Cart summary
CCL21
Catalog Number: orb595645
| Catalog Number | orb595645 |
|---|---|
| Category | Tools |
| Description | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Hazard Information | Non-Toxic |
| UniProt ID | BC027918 |
| Protein Sequence | atggctcagtcactggctctgagcctccttatcctggttctggcctttggcatccccaggacccaaggcagtgatggaggggctcaggactgttgcctcaagtacagccaaaggaagattcccgccaaggttgtccgcagctaccggaagcaggaaccaagcttaggctgctccatcccagctatcctgttcttgccccgcaagcgctctcaggcagagctatgtgcagacccaaaggagctctgggtgcagcagctgatgcagcatctggacaagacaccatccccacagaaaccagcccagggctgcaggaaggacaggggggcctccaagactggcaagaaaggaaagggctccaaaggctgcaagaggactgagcggtcacagacccctaaagggccatag |
| Note | For research use only |
| Application notes | Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 7
- Item 1 of 2
Human CCL21 protein (Active) [orb359078]
> 97% as determined by SDS-PAGE and HPLC.
12.2 kDa
E.Coli
5 μg, 100 μg, 500 μg - Item 1 of 1
Recombinant Murine Exodus-2/CCL21 [orb1906013]
> 97 % by SDS-PAGE and HPLC analyses.
Approximately 12.1 kDa, a single, non-glycosylated polypeptide chain containing 110 amino acids.
Escherichia coli
100 μg, 5 μg, 500 μg - Item 1 of 1
Recombinant Human Exodus-2/CCL21 [orb1906054]
> 95 % by SDS-PAGE analyses.
Approximately 12.2 kDa, a single, non-glycosylated polypeptide chain containing 111 amino acids.
Escherichia coli
100 μg, 5 μg, 500 μg - Item 1 of 2
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars