C1orf170

• Catalog Number: orb599753
• Category: Tools
• Description: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Hazard Information: Non-Toxic
• UniProt ID: BC006300
• Protein Sequence: atgtgcctggtgtttgtagcttttgccacctgggctgtgaggacgtcagatccgcataccccagacgcctggaaaacagccttgctggccaacgtcggcaccatctctgccatccgctacttccgccggcaggcggggcaagggcgccgcagccacagccccagccccagctcctag
• Note: For research use only
• Application notes: Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Expiration Date: 12 months from date of receipt.