You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527521 |
---|---|
Category | Tools |
Description | ARHGEF18 |
UniProt ID | BC008016 |
Protein Sequence | atgtcccagggcatgcagaggatgcacctagagacgttgcagcaagtggacaagtggccgctgtgcgggcccctcgcttgtagtgagctgttgcagcttacggtccgttccctggaggggtggaggaaggaggtgttgggcagcatcaaaggtgctgggacatcccagggtggtgagatccatccacgatccagctccggtggagaaagggcccatgtcaagccttgttctgcaccccaagcattggtggtaggactgggtcctggctga |
Note | For research use only |
Application notes | Vector: pENTR223.1 |
Expiration Date | 12 months from date of receipt. |
ICC, IHC-P, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, WB | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
Filter by Rating