You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527557 |
---|---|
Category | Tools |
Description | SUMO1 |
DNA Notes | pENTR223.1 |
atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaatgaattcactcaggtttctctttgagggtcagagaattgctgataatcatactccaaaagaactgggaatggaggaagaagatgtgattgaagtttatcaggaacaaacggggggtcattcaacagtttag | |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC006462 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
FC, ICC, IF, IHC | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, FC, IF | |
Bovine, Canine, Human | |
Goat | |
Polyclonal | |
Unconjugated |