You have no items in your shopping cart.
Cart summary
RSPO2
Catalog Number: orb527752
| Catalog Number | orb527752 |
|---|---|
| Category | Tools |
| Description | RSPO2 |
| UniProt ID | BC027938 |
| Protein Sequence | atgcgccagtatggagagtgcctgcattcctgcccatccgggtactatggacaccgagccccagatatgaacagatgtgcaagatgcagaatagaaaactgtgattcttgctttagcaaagacttttgtaccaagtgcaaagtaggcttttatttgcatagaggccgttgctttgatgaatgtccagatggttttgcaccattagaagaaaccatggaatgtgtggaaggatgtgaagttggtcattggagcgaatggggaacttgtagcagaaataatcgcacatgtggatttaaatggggtctggaaaccagaacacggcaaattgttaaaaagccagtgaaagacacaataccgtgtccaaccattgctgaatccaggagatgcaagatgacaatgaggcattgtccaggagggaagagaacaccaaaggcgaaggagaagaggaacaagaaaaagaaaaggaagctgatagaaagggcccaggagcaacacagcgtcttcctagctacagacagagctaaccaataa |
| Note | For research use only |
| Application notes | Vector: pENTR223.1 |
| Expiration Date | 12 months from date of receipt. |
- Item 1 of 3
- Item 1 of 3
- Item 1 of 3
- Item 1 of 1
Human R-Spondin 3 / RSPO3 (22-146) Protein [orb257810]
Unconjugated
90%
15.9 kDa
Human R-Spondin 3 (22-146), His Tag (orb257810) is expressed from human 293 cells (HEK293). It contains AA Gln 22 - Val 146 (Accession # AAH22367.1).
1 mg, 50 μg
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars