You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb597707 |
---|---|
Category | Tools |
Description | RPS3 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC071669 |
atggcagtgcaaatatccaagaagaggaagtttgtcgctgatggcatcttcaaagctgaactgaatgagtttcttactcgggagctggctgaagatggctactctggagttgaggtgcgagttacaccaaccaggacagaaatcattatcttagccaccagaacacagaatgttcttggtgagaagggccggcggattcgggaactgactgctgtagttcagaagaggtttggctttccagagggcagtgtagagctttatgctgaaaaggtggccactagaggtctgtgtgccattgcccaggcagagtctctgcgttacaaactcctaggagggcttgctgtgcggaggtaa | |
DNA Notes | Vector will be determined during the manufacturing process, either pENTR223.1 or pUC |
Hazard Information | Non-Toxic |
Note | For research use only |
FC, ICC, IF, IHC, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 85% as determined by SDS-PAGE. | |
31.5 kDa | |
E.coli |
ELISA, IHC-P, WB | |
Human, Mouse, Rat | |
Polyclonal | |
Unconjugated |