Availability

  • Request Lead Time
  • In stock and ready for quick dispatch
  • Usually dispatched within 3-7 working days
Shipping Destination:
United States
Shipping charges:
Freight/Packing: $34.00

Need Help?

Ask a Question Support@biorbyt.com
Product Overview
Product Name KIAA1383
Catalog Number orb602933
Hazard InformationNon-Toxic
Sequence ATGGCGGCCTCGCTGTCCGAGCGGCTCTTCTCGCTGGAGCTGCTGGTGGACTGGGTGCGTTTGGAAGCCCGGCTGCTGCCGTCCCCCGCTGCCGCAGTGGAGCAGGAGGAGGAAGAGGAGGAAAAGGAGCAGGGGGAGGCCTCGTCGCCGCGCGGTCTGTGCCCCGCCGTGGCCTTCCGCCTGCTGGACTTCCCCACGCTGTTGGTTTACCCTCCTGACGGCCCCGGCGCTCCCGCCGCCGAACCGTGGCCCGGTGTCATCCGCTTCGGTCGCGGCAAGTCCTGCCTCTTCCGCCTGCAGCCTGCTACCCTGCACTGCCGGCTCCTGCGGACCCCGCTTGCCACCTTGCTGCTGCAGCTGCCCCCTGGGCGCCCGACGCCCACCCCACAGCTCCTGGGGGCCTGCGACATTTCGCTGGCCACCGCAGCGCACAGGGTCGTGGGGCCGGCCGCCTCCGGATGCTCCCACCGTCACCGGGGACGTTTCCCCCTGCATAATCGAGTGGGCGAGCGGACTGGGGACATTGCACTGGCCTACCGCCTGACTGACCTGGGAAGCCGCCTGCTGAGCCAACTTGAGCGGCCCCTCACCTTCACCCGCACAGGAGGAGGAGCGGAGGTCAGTCCCCAAACCCAGCAGGAAAGACAGCAGCTGCAGCAGCCAGCCTCACAGCCAAGCCCAAAAGAGGCTGATAAGCCGCTGGGGGAGTTAGAAATCCCAGAGGCACAGAAGGATTTGAAGGAAATGGTTAAAAGTAAGGCCGAATGTGATAATGTGGGTTCTGTGGAGAATGGCAAAACCAATTCTGTTGTTACATGTTCAGGTGCTGGCAATGGGAGAAATGTTAGCTCCCTAAATGAGGAAGTCACAGAATTGGACATGGAGACCAATATATTTTGCCCTCCTCCTTTGTATTACACTAACTTGACCCAAGAAAAACCGCCCCCTGCACAGGCTAAAATCACCATTGAGCCTCAAATGAATGCACCTGAGGAAATGGATGATGCTTCTCCTGAAAAAAAGCGTGTAAATCCCCCAGCACACAGGAGTTGTCTAAAGCATCCAAGTTCTGCAGCACACGAACATCCTCCAATGCTTGTAAATCCTCCACATATTCAGAATATAGGAGCAACTAATCAAACATGTCAAACTGAACAAAATCGAATTAATACAATAAGGCAGTTGCCTTTGTTAAATGCTTTGTTAGTTGAGTTGTCCTTGTTATATGACCAACCTGTGACAAGTCCTGCTCATATACATCCTCACCTAGCCTGGTTATATAGGACTGAGGATAAGAAGTCACCCGAATCTTCTGCCAAATCCACATGCCGGTCTGAAGCCAAGAAGGATAAGCGTTCTGTGGGGGGATGTGAAAAGTCAGTGAGTCTTCAGTATAAAAAGAACCAAATTGAAAACTATAAGGAAGATAAATATTCTGAAAAGAGCAGTGGTGCCCTCCATAAAAGAGTTCCAAAAGGGAGGCTACTTTATGGCTTAACAAATACACTAAGACTACGTTTAAAGCTGACAAATCCTGATATGTTGGTGGTACATGAAAAAAGAGAACTATATAGAAAAAGACAATCACAAATGTTGGGTACAAAATTCAGAATTCCGTCATCCAAAGTTAAACTATTAAGCTCTGCAGAACAAAGTCAGAAGCCACAACTGCCTGAAGATAAGTATTTAGATTCAGATGCATCTTTCACTGAAAATAGTGATACCTCAAGACAAATCAGTGGAGTTTTTGATGAGCCCAGCACAAGTAAAGAAACTAAACTGAAATATGCAACTGAAAAAAAGACAGTTGATTGTAGTAAAAATAGAATCAATAATGTTTCATTGGAAGAAGTTGTGAGTCCTGCAAATTCCATTATTCCAGAAAGGCTTACCCCTACAAATATTCTGGGAGGAAATGTGGAAATGAAAATCCAAAGTCCATGTGTTTTCCAACAGGATGCTGTTGTTGACAGAATTGTAGATAAGGAAATAGATATTAGACAGGTCAAAACCACAGATAATGACATTCTTATGGCTGATATAAGTGACAAGAGAACAGGTAAAAATAGTTGCTATGAAAACATCTCAGAACTGAAGTATTCAGATGATTTGTCTAGCCCTTGCTATTCTGAAGATTTCTGTACCAGTGAGGACACCAGCAGAAGTTTCAAAGCTCATGATAGCAGTTCAAGGACAGAAAATCCAAAACATAGTCAATATACAAGCAAGTCTAGTGACACAGGAGTGTCCAAAAAGAAAAATAGTAGTGACAGGAGTTCTATCCTTAGCCCACCTTTTTCAGCCGGGTCACCTGTACACTCATACAGAAAATTTCATATTTCAAAGACTCAGGATAAAAGTTTGGAGGAAGCATCTAGTATCTCTGCTAGTGATTTATCTTCAACACATTGGACTGAACAAAAAGAAAACCAGATAGATCAAAATAGTATGCACAATTCTGAAATTACAAAGAGAGCTCAAGACATCTCTGTTAAAACAAGAAGTAGTTGGAAATCTTTAGAAAAAAGCCAGTCACCACAAACATCCCAGGTGAGTTCTTACCTGCCTTCAAATGTGTCCGAACTTAATGTCCTGGATAGCAGTACATCAGATCACTTTGAAGAAGGCAATGATGATGTTGGTTCACTAAATATTTCCAAGCAATGCAAAGATATTTGTGAATTAGTAATAAATAAACTTCCAGGATACACAATGTAA
Target KIAA1383
Product Properties
Note For research use only.
NCBI BC109122
Entrez 54627
Product Description

Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Reviews
Write Your Own Review
You're reviewing:KIAA1383 - orb602933
Your Rating