You have no items in your shopping cart.
Cart summary
POP7
Catalog Number: orb527644
| Catalog Number | orb527644 |
|---|---|
| Category | Tools |
| Description | POP7 |
| Form/Appearance | 10 μg plasmid + 200μl Glycerol |
| UniProt ID | BC001430 |
| atggcagaaaaccgagagccccgcggtgctgtggaggctgaactggatccagtggaatacacccttaggaaaaggcttcccagccgcctgccccggagacccaatgacatttatgtcaacatgaagacggactttaaggcccagctggcccgctgccagaagctgctggacggaggggcccggggtcagaacgcgtgctctgagatctacattcacggcttgggcctggccatcaaccgcgccatcaacatcgcgctgcagctgcaggcgggcagcttcgggtccttgcaggtggctgccaatacctccaccgtggagcttgttgatgagctggagccagagaccgacacacgggagccactgactcggatccgcaacaactcagccatccacatccgagtcttcagggtcacacccaagtaa | |
| DNA Notes | pENTR223.1 |
| Note | For research use only |
- Item 1 of 1
Human POP7 protein [orb54345]
Greater than 90% as determined by SDS-PAGE.
42.7 kDa
E.coli
20 μg, 100 μg, 1 mg - Item 1 of 2
- Item 1 of 1
- Item 1 of 1
