You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527485 |
---|---|
Category | Tools |
Description | MT2A |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC007034 |
atggatcccaactgctcctgcgccgccggtgactcctgcacctgcgccggctcctgcaaatgcaaagagtgcaaatgcacctcctgcaagaaaagctgctgctcctgctgccctgtgggctgtgccaagtgtgcccagggctgcatctgcaaaggggcgtcggacaagtgcagctgctgcgcctga | |
DNA Notes | pENTR223.1 |
Note | For research use only |
FC, IF, IHC-Fr, IHC-P | |
Rat | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
Greater than 90% as determined by SDS-PAGE. | |
7.9 kDa | |
Yeast |
Greater than 90% as determined by SDS-PAGE. | |
32.9 kDa | |
E.coli |