You have no items in your shopping cart.
Cart summary
MT1B
Catalog Number: orb527488
| Catalog Number | orb527488 |
|---|---|
| Category | Tools |
| Description | MT1B |
| UniProt ID | BC069421 |
| Protein Sequence | atggatcccaactgctcctgcaccacaggtggctcctgtgcctgcgccggctcctgcaagtgcaaagagtgcaaatgtacctcctgcaagaagtgctgctgctcttgctgccccgtgggctgtgccaagtgtgcccagggctgtgtctgcaaaggctcatcagagaagtgccgctgctgtgcctga |
| Note | For research use only |
| Application notes | Vector: pENTR223.1 |
| Expiration Date | 12 months from date of receipt. |
Submit a review
Filter by Rating
- 5 stars
- 4 stars
- 3 stars
- 2 stars
- 1 stars