You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527578 |
---|---|
Category | Tools |
Description | INS |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC005255 |
atggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgcaactag | |
DNA Notes | pENTR223.1 |
Note | For research use only |
IHC, WB | |
Canine, Guinea pig, Mouse, Rabbit, Rat | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P | |
Bovine, Equine, Human, Porcine, Rabbit | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P, WB | |
Porcine | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-Fr, IHC-P, WB | |
Mouse, Rat | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |