You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527556 |
---|---|
Category | Tools |
Description | EPAS1 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC015869 |
atggtctttcacacggcacatttggacatttccagaactaccatgagatggtttagacgggaattcatgcaaatgaggggtcaaaaatggtatagtgaccccgtccacgtcctccaagctcacgaccttggagccccgtggagctggactgaggaggaggctgcacagcgggagagcagctggtccagaccagccctgcagcccccactcagccggcagccagatggccccgcaaggcctccagggatggcccctagccacaggccctggctgaggtctctgggtcggtcagtgacatgtaggtag | |
DNA Notes | pENTR223.1 |
Note | For research use only |
FC, ICC, WB | |
Human | |
Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
ICC, IF, IHC-P, WB | |
Guinea pig, Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IHC-P, WB | |
Human, Mouse, Rat | |
Rabbit | |
Polyclonal | |
Unconjugated |
IF, IH, WB | |
Human, Mouse | |
Rabbit | |
Polyclonal | |
Unconjugated |
ELISA, IF, IHC-P, WB | |
Human, Mouse, Rat | |
Polyclonal | |
Unconjugated |