You have no items in your shopping cart.
You have no items in your shopping cart.
Catalog Number | orb527588 |
---|---|
Category | Tools |
Description | CXCL6 |
Form/Appearance | 10 μg plasmid + 200μl Glycerol |
UniProt ID | BC013744 |
atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaaccccaaaacgattggtaaactgcaggtgttccccgcaggcccgcagtgctccaaggtggaagtggtagcctccctgaagaacgggaagcaagtttgtctggacccggaagccccttttctaaagaaagtcatccagaaaattttggacagtggaaacaagaaaaactga | |
DNA Notes | pENTR223.1 |
Note | For research use only |
Expiration Date | 12 months from date of receipt. |
> 98% as determined by SDS-PAGE and HPLC. | |
7.9 kDa | |
E.Coli |
> 98 % by SDS-PAGE and HPLC analyses. | |
Approximately 7.9 kDa, a single non-glycosylated polypeptide chain containing 72 amino acids. | |
Escherichia coli |
> 97 % by SDS-PAGE and HPLC analyses. | |
Approximately 8.0 kDa, a single non-glycosylated polypeptide chain containing 76 amino acids. | |
Escherichia coli |
ELISA, IF, IHC-Fr, IHC-P, WB | |
Bovine, Equine, Human | |
Human | |
Rabbit | |
Polyclonal | |
Unconjugated |